Department of Physics, Chemistry and Biology (IFM)

PCR of genomic DNA

Extraction of genomic DNA from Populus cell culture and from Arabidopsis

Genomic DNA was extracted from a Populus trichocarpa cell culture using the QIAGEN DNeasy Plant Mini Kit according to the manufacturer’s protocol. Arabidopsis genomic DNA was kindly donated by Dr. Nomchit Kaewthai.

Primer design

The primers were designed to amplify upstream regulatory regions of MYB46, VND7 and NST1 in Populus trichorpa and Arabidopsis thaliana with additional 35 bp sequence overlapping vector. The primers were designed based on the annotated genes in the genomes of Populus trichorpa and Arabidopsis thaliana available in public databases (www.phytozome.net). All primers were designed to amplify a 1500 bp fragment directly upstream of the genes’ translational start, ATG.

 

Primers used in this study.

                                          

  Primer                                            AtVND7P       

-U (forward, 5’ to 3’)                       ACAGGAAACAGCTATGACCATGATACGCCAAGCT     

-L (reverse, 5' to 3')                        GGACGTAACATAAGGGACTGACCTACCCGGGGATC

 

 Primer                                              AtNST1P       

-U (forward, 5’ to 3’)                       ACAGGAAACAGCTATGACCATGATACGCCAAGCT     

-L (reverse, 5' to 3')                       GACGTAACATAAGGGACTGACCTACCCGGGGATCC

 

  Primer                                             AtMYB46P    

-U (forward, 5’ to 3’)                       ATGAGAGCTTGGAGTGAGAGGT                                   

-L (reverse, 5' to 3')                        CGTAACATAAGGGACTGACCTACCCGGGGATCA

 

 Primer                                              PtVND7P     

-U (forward, 5’ to 3’)                       ACAGGAAACAGCTATGACCATGATACGCCAAGCT      

-L (reverse, 5' to 3')                        GGACGTAACATAAGGGACTGACCTACCCGGGGATC

 

  Primer                                             PtNST1P      

-U (forward, 5’ to 3’)                       CAGGAAACAGCTATGACCATGATTACGCCAAGCT     

-L (reverse, 5' to 3')                        GGACGTAACATAAGGGACTGACCTACCCGGGGATC

 

Primer                                               PtMYB46P    

-U (forward, 5’ to 3’)                       ACAGGAAACAGCTATGACCATGATACGCCAAGCT    

-L (reverse, 5' to 3')                        GGACGTAACATAAGGGACTGACCTACCCGGGGATC

 

PCR

PCR of genomic DNA was carried out using 0,5 μ g total genomic DNA, 100 μ M primers, 10 mM dNTP and Phusion DNA polymerase (Finnzymes) according to the manufacturer’s instructions. MgCl2 concentrations were varied to optimize the result.

 

Cloning methods

Overlap extension cloning

Overlap extension cloning was performed according to Bryksin and Matsumura 2010. The linearized vectors were obtained by restriction enzyme digestion of a GUS reporter construct, pCF202 (Ezcurra et al. 1999). The vector overlapping sequences were added on to the promoter fragments using PCR and gel purification. The vector was mixed with the insert DNA and overlap extension was performed by using a Phusion DNA polymerase reaction mixture. The insert and the vector were denatured at 98°C for 30 seconds, and then annealed at 55°c for 30 seconds and polymerase extension were done for 9 minutes at 72°c per kb. This cycle was repeated five times, and 1 μ l of this reaction mixture was used to transform competent cells using tetracycline selection. Clones were analyzed by PCR screen of bacterial colonies, restriction enzyme digestion and sequencing using standard methods.

 

Agroinfiltration

Growth of plants

Nicotiana benthamiana is a winter annual. The growth conditions were the seeds were germinated 1 week on hydrated moss peat tablets, and then seedlings were transferred to vermiculite pots, grown 4 weeks at 25°C, light regime 16 h light 8 h dark, and watered periodically with a commercial fertilizer for indoor house plants.

 

Transformation of Agrobacterium tumefaciens

Agrobacterium tumefaciens strain C58C1-RS (pCH32) was transformed using the freeze-thaw

method (Wise et al. 2006).

 

Agroinfiltration

Agroinfiltration is a process to directly introduce A. tumefaciens cells carrying the desired transgene into the plant leaf through the stomata. A syringe without needle is placed on the leaf lower surface and then pressure is applied gently to force the solution containing Agrobacterium strains into Nicotiana benthamiana leaf. Agroinfiltration was carried out on 4-week-old plants according to Winzell et al. (2010). After 5 days, 0.5-cm leaf discs were cut and assayed for GUS activity.

 

GUS assay

GUS activity of leaf discs was measured using a colorimetric assay (Leborgne-Castel et al.1999). Single N. benthamiana leaf discs were ground using a plastic pestle with 200 μ l of GUS extract buffer (50mM phosphate buffer, pH 7.0, 10mM EDTA, 0.1% sodium lauryl sarcosine, 0.1% Triton -100 and freshly added 10mM mercaptoethanol) in an eppendorf tube. The tubes are then centrifuges for 10 minutes at 4°C and the cleared extracts is kept in 6°C. Sample buffer is exchanged by adding 300 μ l of GUS assay buffer (50mM phosphate buffer, pH7.0, 0.1% TritonX-100 and 10mM freshly added mercaptoethanol) to 40 μ l of cleared extract in eppendorf tubes. A microtiter plate is used to measure the activity of GUS. The diluted extract is added into two wells, where one well is supplied with the GUS colorimetric substrate, PNPG, whereas the other one is not, representing eventual background (from enzymatic activity or yellow pigments), the value of which is subtracted from the PNPG value. Thus, to the background control sample

100 μ l of GUS assay M is added, whereas the GUS activity sample is supplied with 100 μ l of GUS assay buffer with freshly added PNPG (2 mM final concentration). Then it is incubated at 37°C until yellow color develops. The absorbance is measured in a microtiter plate reader at OD 405nm. GUS activity was calculated in terms of moles product (p-nitrophenyl) per minute (reaction time) per gram total protein after subtracting the background and taking into account that the molar extinction coefficient for p-nitrophenyl is 18 000 M-1cm-1. An empirically determined constant was used to account for measuring absorbance in a microtiter plate and not

in a 1 cm cuvette. The protein concentration of leaf discs was measured using the Bio-Rad Protein Assay (which uses the Bradford method) according to the manufacturer’s instructions. The protein concentration was calculated from the obtained OD600 values using a BSA protein standard curve.